AAV-Best1-sCX3CL1
(Plasmid
#164422)
-
PurposeAAV plasmid expressing soluble CX3CL1 (fractalkine) in retinal pigment epithelium
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164422 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV-MCS8
-
Backbone manufacturerJeng-Shin Lee, Harvard University
- Backbone size w/o insert (bp) 4768
- Total vector size (bp) 5796
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCx3cl1
-
Alt namefractalkine
-
Alt nameneurotactin
-
Alt nameC-X3-C Motif Chemokine Ligand 1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1028
-
Mutationdeleted terminal 59 amino acids
-
Entrez GeneCx3cl1 (a.k.a. AB030188, ABCD-3, AI848747, CX3C, Cxc3, D8Bwg0439e, Scyd, Scyd1, fract, neuro)
- Promoter Best1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gatctagctcctgggctgag
- 3′ sequencing primer gctcttgggaagtccccatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-Best1-sCX3CL1 was a gift from Connie Cepko (Addgene plasmid # 164422 ; http://n2t.net/addgene:164422 ; RRID:Addgene_164422) -
For your References section:
Soluble CX3CL1 gene therapy improves cone survival and function in mouse models of retinitis pigmentosa. Wang SK, Xue Y, Rana P, Hong CM, Cepko CL. Proc Natl Acad Sci U S A. 2019 May 14;116(20):10140-10149. doi: 10.1073/pnas.1901787116. Epub 2019 Apr 29. 10.1073/pnas.1901787116 PubMed 31036641