Skip to main content
Addgene

AAV-Best1-sCX3CL1
(Plasmid #164422)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164422 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV-MCS8
  • Backbone manufacturer
    Jeng-Shin Lee, Harvard University
  • Backbone size w/o insert (bp) 4768
  • Total vector size (bp) 5796
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cx3cl1
  • Alt name
    fractalkine
  • Alt name
    neurotactin
  • Alt name
    C-X3-C Motif Chemokine Ligand 1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1028
  • Mutation
    deleted terminal 59 amino acids
  • Entrez Gene
    Cx3cl1 (a.k.a. AB030188, ABCD-3, AI848747, CX3C, Cxc3, D8Bwg0439e, Scyd, Scyd1, fract, neuro)
  • Promoter Best1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer gatctagctcctgggctgag
  • 3′ sequencing primer gctcttgggaagtccccatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-Best1-sCX3CL1 was a gift from Connie Cepko (Addgene plasmid # 164422 ; http://n2t.net/addgene:164422 ; RRID:Addgene_164422)
  • For your References section:

    Soluble CX3CL1 gene therapy improves cone survival and function in mouse models of retinitis pigmentosa. Wang SK, Xue Y, Rana P, Hong CM, Cepko CL. Proc Natl Acad Sci U S A. 2019 May 14;116(20):10140-10149. doi: 10.1073/pnas.1901787116. Epub 2019 Apr 29. 10.1073/pnas.1901787116 PubMed 31036641