3XHalo_GFP_TRF1#1
(Plasmid
#164644)
-
Purposetag TRF1 with GFP and Halo
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164644 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneRMCE
- Backbone size w/o insert (bp) 9438
- Total vector size (bp) 10677
-
Vector typeMammalian Expression, Cre/Lox
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTRF1
-
Alt nameTERF1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1239
-
Entrez GeneTERF1 (a.k.a. PIN2, TRBF1, TRF, TRF1, hTRF1-AS, t-TRF1)
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI-HF (not destroyed)
- 3′ cloning site Bsu36I (destroyed during cloning)
- 5′ sequencing primer TCAACACTTCAGCTACAACCAC
- 3′ sequencing primer TCCATCATGTGGTTGTAGCTG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
TRF1 is from Roger Greenberg lab
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3XHalo_GFP_TRF1#1 was a gift from Michael Lampson & Huaiying Zhang (Addgene plasmid # 164644 ; http://n2t.net/addgene:164644 ; RRID:Addgene_164644) -
For your References section:
Nuclear body phase separation drives telomere clustering in ALT cancer cells. Zhang H, Zhao R, Tones J, Liu M, Dilley RL, Chenoweth DM, Greenberg RA, Lampson MA. Mol Biol Cell. 2020 Aug 15;31(18):2048-2056. doi: 10.1091/mbc.E19-10-0589. Epub 2020 Jun 24. 10.1091/mbc.E19-10-0589 PubMed 32579423