pNTI757 P(PGK1)-citrine P(HIS4)-mCherry
(Plasmid
#164917)
-
PurposeDivergent promoter expression cassette, P(HIS4) expression with P(PGK1) normalizer
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164917 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR™Blunt II-TOPO®
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 6100
-
Modifications to backboneRemoved a chunk that included the BamHI and SpeI restriction sites
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameP(PGK1)-citrine and P(HIS4)-mCherry
-
SpeciesS. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)2623
- Promoter PGK1 (yeast) and HIS4 (yeast)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTTAGGTGACACTATAG
- 3′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Digesting this plasmid with BciVI leaves compatible Gibson homology arms on either side of divergent promoter expression cassette, allowing direct Gibson assembly into the barcoded-gRNA plasmid library. See manuscript for additional details.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNTI757 P(PGK1)-citrine P(HIS4)-mCherry was a gift from Nicholas Ingolia (Addgene plasmid # 164917 ; http://n2t.net/addgene:164917 ; RRID:Addgene_164917) -
For your References section:
CiBER-seq dissects genetic networks by quantitative CRISPRi profiling of expression phenotypes. Muller R, Meacham ZA, Ferguson L, Ingolia NT. Science. 2020 Dec 11;370(6522). pii: 370/6522/eabb9662. doi: 10.1126/science.abb9662. 10.1126/science.abb9662 PubMed 33303588