pNTI757 P(PGK1)-citrine P(HIS4)-mCherry
(Plasmid #164917)

• Purpose: Divergent promoter expression cassette, P(HIS4) expression with P(PGK1) normalizer
• Depositing Lab: Nicholas Ingolia
• Publication: Muller et al Science. 2020 Dec 11;370(6522). pii: 370/6522/eabb9662. doi: 10.1126/science.abb9662.

Backbone

• Vector backbone: pCR™Blunt II-TOPO®
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 3500
• Total vector size (bp): 6100
• Modifications to backbone: Removed a chunk that included the BamHI and SpeI restriction sites
• Vector type: Yeast Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: P(PGK1)-citrine and P(HIS4)-mCherry
• Species: S. cerevisiae (budding yeast), Synthetic
• Insert Size (bp): 2623
• Promoter: PGK1 (yeast) and HIS4 (yeast)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATTTAGGTGACACTATAG
• 3′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • pNTI757 P(PGK1)-citrine P(HIS4)-mCherry
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Digesting this plasmid with BciVI leaves compatible Gibson homology arms on either side of divergent promoter expression cassette, allowing direct Gibson assembly into the barcoded-gRNA plasmid library. See manuscript for additional details.