Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

MSCVpic2neo-hTERT-p16 shRNA
(Plasmid #164920)


Item Catalog # Description Quantity Price (USD)
Plasmid 164920 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7166
  • Total vector size (bp) 10398
  • Vector type
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    human telomerase reverse transcriptase
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    TERT (a.k.a. CMM9, DKCA2, DKCB4, EST2, PFBMFT1, TCS1, TP2, TRT, hEST2, hTRT)
  • Tag / Fusion Protein
    • HA tag (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site FseI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer tcctgcctgaaggagctggtg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    CDKN2A (a.k.a. ARF, CDK4I, CDKN2, CMM2, INK4, INK4A, MLM, MTS-1, MTS1, P14, P14ARF, P16, P16-INK4A, P16INK4, P16INK4A, P19, P19ARF, TP16)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho 1 (unknown if destroyed)
  • 3′ cloning site Eco R1 (unknown if destroyed)
  • 5′ sequencing primer CGACTAGGGATAACAGGGTAATTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCVpic2neo-hTERT-p16 shRNA was a gift from Ji Luo (Addgene plasmid # 164920 ; ; RRID:Addgene_164920)
  • For your References section:

    One-step immortalization of primary human airway epithelial cells capable of oncogenic transformation. Smith JL, Lee LC, Read A, Li Q, Yu B, Lee CS, Luo J. Cell Biosci. 2016 Nov 11;6:57. doi: 10.1186/s13578-016-0122-6. eCollection 2016. 10.1186/s13578-016-0122-6 PubMed 27891214