-
PurposeExpression of RfxCas13d sgRNAs from a U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165078 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiGuide-Puro
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameScaffold gRNA
-
gRNA/shRNA sequenceaacccctaccaactggtcggggtttgaaac
-
SpeciesOther
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that viral vectors are prone to recombination. Addgene recommends testing 2-4 individual colonies to ensure the full plasmid is intact.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RfxCas13d-backbone was a gift from Ling-Ling Chen (Addgene plasmid # 165078 ; http://n2t.net/addgene:165078 ; RRID:Addgene_165078) -
For your References section:
Screening for functional circular RNAs using the CRISPR-Cas13 system. Li S, Li X, Xue W, Zhang L, Yang LZ, Cao SM, Lei YN, Liu CX, Guo SK, Shan L, Wu M, Tao X, Zhang JL, Gao X, Zhang J, Wei J, Li J, Yang L, Chen LL. Nat Methods. 2021 Jan;18(1):51-59. doi: 10.1038/s41592-020-01011-4. Epub 2020 Dec 7. 10.1038/s41592-020-01011-4 PubMed 33288960