Skip to main content

pSpCas9_U6_sgRNA_Mettl3C
(Plasmid #165420)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165420 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    px459 v2
  • Backbone manufacturer
    Dr. Feng Zhang's Lab
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PspCas9 gRNA targeting Mettl3 C-terminus
  • gRNA/shRNA sequence
    AAGGTGTGGCCTGTAGCCCA
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_019721
  • Entrez Gene
    Mettl3 (a.k.a. 2310024F18Rik, M6A, Spo8)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer unknown
  • 3′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9_U6_sgRNA_Mettl3C was a gift from Neil Brockdorff (Addgene plasmid # 165420 ; http://n2t.net/addgene:165420 ; RRID:Addgene_165420)
  • For your References section:

    Acute depletion of METTL3 implicates N (6)-methyladenosine in alternative intron/exon inclusion in the nascent transcriptome. Wei G, Almeida M, Pintacuda G, Coker H, Bowness JS, Ule J, Brockdorff N. Genome Res. 2021 Aug;31(8):1395-1408. doi: 10.1101/gr.271635.120. Epub 2021 Jun 15. 10.1101/gr.271635.120 PubMed 34131006