Skip to main content

pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
(Plasmid #165450)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165450 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4670
  • Total vector size (bp) 7167
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    dCas9N-IntN
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    2490
  • Promoter short human rhodopsin promoter

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggtcagaacccagagtcatc
  • 3′ sequencing primer ATTCTAGTTGTGGTTTGTCCAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    3x Opn1mw promoter-targeting sgRNAs
  • Species
    Streptococcus pyogenes
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SgsI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer agatcggaattcgcccttaa
  • 3′ sequencing primer ACACTAGGAGGAAGCCTGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA was a gift from Elvir Becirovic (Addgene plasmid # 165450 ; http://n2t.net/addgene:165450 ; RRID:Addgene_165450)
  • For your References section:

    A gene therapy for inherited blindness using dCas9-VPR-mediated transcriptional activation. Bohm S, Splith V, Riedmayr LM, Rotzer RD, Gasparoni G, Nordstrom KJV, Wagner JE, Hinrichsmeyer KS, Walter J, Wahl-Schott C, Fenske S, Biel M, Michalakis S, Becirovic E. Sci Adv. 2020 Aug 19;6(34):eaba5614. doi: 10.1126/sciadv.aba5614. eCollection 2020 Aug. 10.1126/sciadv.aba5614 PubMed 32875106