pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
(Plasmid
#165450)
-
PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165450 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4670
- Total vector size (bp) 7167
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namedCas9N-IntN
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)2490
- Promoter short human rhodopsin promoter
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ggtcagaacccagagtcatc
- 3′ sequencing primer ATTCTAGTTGTGGTTTGTCCAA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert name3x Opn1mw promoter-targeting sgRNAs
-
SpeciesStreptococcus pyogenes
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SgsI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer agatcggaattcgcccttaa
- 3′ sequencing primer ACACTAGGAGGAAGCCTGAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypSMVP-Cas9N, Addgene plasmid 80934
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA was a gift from Elvir Becirovic (Addgene plasmid # 165450 ; http://n2t.net/addgene:165450 ; RRID:Addgene_165450) -
For your References section:
A gene therapy for inherited blindness using dCas9-VPR-mediated transcriptional activation. Bohm S, Splith V, Riedmayr LM, Rotzer RD, Gasparoni G, Nordstrom KJV, Wagner JE, Hinrichsmeyer KS, Walter J, Wahl-Schott C, Fenske S, Biel M, Michalakis S, Becirovic E. Sci Adv. 2020 Aug 19;6(34):eaba5614. doi: 10.1126/sciadv.aba5614. eCollection 2020 Aug. 10.1126/sciadv.aba5614 PubMed 32875106