Skip to main content

pEMPTY::sgRNA2
(Plasmid #165459)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165459 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCN38, pMAD
  • Total vector size (bp) 11277
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology
  • Selectable markers
    In Gram-positive bacteria: chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA2
  • gRNA/shRNA sequence
    Sequence conserved in Staphylococcus aureus plasmids
  • Species
    Staphylococcus aureus
  • Promoter SP01

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site SmaI (not destroyed)
  • 5′ sequencing primer cgatttttgtgatgctcgtcaggg
  • 3′ sequencing primer cgtaaacggatgctggctag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEMPTY::sgRNA2 was a gift from Inigo Lasa (Addgene plasmid # 165459 ; http://n2t.net/addgene:165459 ; RRID:Addgene_165459)
  • For your References section:

    Fitness Cost Evolution of Natural Plasmids of Staphylococcus aureus. Dorado-Morales P, Garcillan-Barcia MP, Lasa I, Solano C. mBio. 2021 Feb 23;12(1). pii: mBio.03094-20. doi: 10.1128/mBio.03094-20. 10.1128/mBio.03094-20 PubMed 33622733