pEMPTY::sgRNA2
(Plasmid
#165459)
-
PurposeEscherichia coli – Staphylococcus aureus shuttle vector for plasmid curing in Gram-positive bacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165459 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCN38, pMAD
- Total vector size (bp) 11277
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
-
Selectable markersIn Gram-positive bacteria: chloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA2
-
gRNA/shRNA sequenceSequence conserved in Staphylococcus aureus plasmids
-
SpeciesStaphylococcus aureus
- Promoter SP01
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site SmaI (not destroyed)
- 5′ sequencing primer cgatttttgtgatgctcgtcaggg
- 3′ sequencing primer cgtaaacggatgctggctag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEMPTY::sgRNA2 was a gift from Inigo Lasa (Addgene plasmid # 165459 ; http://n2t.net/addgene:165459 ; RRID:Addgene_165459) -
For your References section:
Fitness Cost Evolution of Natural Plasmids of Staphylococcus aureus. Dorado-Morales P, Garcillan-Barcia MP, Lasa I, Solano C. mBio. 2021 Feb 23;12(1). pii: mBio.03094-20. doi: 10.1128/mBio.03094-20. 10.1128/mBio.03094-20 PubMed 33622733