OmEF1aCas9P2ApuroSB
(Plasmid
#165484)
-
PurposeStable expression of a zebrafish optimized Cas9 driven by a tilapia promoter in fish cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165484 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBbi-GP
-
Backbone manufacturerEric Kowarz Lab (Addgene #60511)
- Backbone size w/o insert (bp) 6640
- Total vector size (bp) 8719
-
Modifications to backbone4021 bp between a PvuII and NdeI site (including backbone promoters, EGFP, P2A, and puromycin resistance) was removed and replaced with a new Cas9-P2A-Puromycin resistance expression cassette.
-
Vector typeCRISPR ; Transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZebrafish optimized Cas9 (nls-zcas9-nls from Wenbiao Chen Lab plasmid pCS2-nCas9n Addgene #47929)
-
SpeciesSynthetic
-
Insert Size (bp)4147
- Promoter Oreochromis mossambicus EF1 alpha promoter (OmEF1a)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PvuII (destroyed during cloning)
- 3′ cloning site NdeI (not destroyed)
- 5′ sequencing primer GATGTTTCGGTAAGGGGTCC
- 3′ sequencing primer CAGCCACCACCTTCTGATAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe zebrafish opitmized Cas9 coding sequence (nls-zcas9-nls) was obtained from Addgene plasmid pCS2-nCas9n (Plasmid #47929 Wenbiao Chen Lab).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OmEF1aCas9P2ApuroSB was a gift from Dietmar Kueltz (Addgene plasmid # 165484 ; http://n2t.net/addgene:165484 ; RRID:Addgene_165484) -
For your References section:
An efficient vector-based CRISPR/Cas9 system in an Oreochromis mossambicus cell line using endogenous promoters. Hamar J, Kultz D. Sci Rep. 2021 Apr 12;11(1):7854. doi: 10.1038/s41598-021-87068-3. 10.1038/s41598-021-87068-3 PubMed 33846462