Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

OmEF1aCas9P2ApuroSB
(Plasmid #165484)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 165484 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSBbi-GP
  • Backbone manufacturer
    Eric Kowarz Lab (Addgene #60511)
  • Backbone size w/o insert (bp) 6640
  • Total vector size (bp) 8719
  • Modifications to backbone
    4021 bp between a PvuII and NdeI site (including backbone promoters, EGFP, P2A, and puromycin resistance) was removed and replaced with a new Cas9-P2A-Puromycin resistance expression cassette.
  • Vector type
    CRISPR ; Transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Zebrafish optimized Cas9 (nls-zcas9-nls from Wenbiao Chen Lab plasmid pCS2-nCas9n Addgene #47929)
  • Species
    Synthetic
  • Insert Size (bp)
    4147
  • Promoter Oreochromis mossambicus EF1 alpha promoter (OmEF1a)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PvuII (destroyed during cloning)
  • 3′ cloning site NdeI (not destroyed)
  • 5′ sequencing primer GATGTTTCGGTAAGGGGTCC
  • 3′ sequencing primer CAGCCACCACCTTCTGATAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The zebrafish opitmized Cas9 coding sequence (nls-zcas9-nls) was obtained from Addgene plasmid pCS2-nCas9n (Plasmid #47929 Wenbiao Chen Lab).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    OmEF1aCas9P2ApuroSB was a gift from Dietmar Kueltz (Addgene plasmid # 165484 ; http://n2t.net/addgene:165484 ; RRID:Addgene_165484)
  • For your References section:

    An efficient vector-based CRISPR/Cas9 system in an Oreochromis mossambicus cell line using endogenous promoters. Hamar J, Kultz D. Sci Rep. 2021 Apr 12;11(1):7854. doi: 10.1038/s41598-021-87068-3. 10.1038/s41598-021-87068-3 PubMed 33846462