OmEF1aCas9P2ApuroSB
(Plasmid #165484)

• Purpose: Stable expression of a zebrafish optimized Cas9 driven by a tilapia promoter in fish cells
• Depositing Lab: Dietmar Kueltz
• Publication: Hamar et al Sci Rep. 2021 Apr 12;11(1):7854. doi: 10.1038/s41598-021-87068-3.

Backbone

• Vector backbone: pSBbi-GP
• Backbone manufacturer: Eric Kowarz Lab (Addgene #60511)
• Backbone size w/o insert (bp): 6640
• Total vector size (bp): 8719
• Modifications to backbone: 4021 bp between a PvuII and NdeI site (including backbone promoters, EGFP, P2A, and puromycin resistance) was removed and replaced with a new Cas9-P2A-Puromycin resistance expression cassette.
• Vector type: CRISPR ; Transposon
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Zebrafish optimized Cas9 (nls-zcas9-nls from Wenbiao Chen Lab plasmid pCS2-nCas9n Addgene #47929)
• Species: Synthetic
• Insert Size (bp): 4147
• Promoter: Oreochromis mossambicus EF1 alpha promoter (OmEF1a)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PvuII (destroyed during cloning)
• 3′ cloning site: NdeI (not destroyed)
• 5′ sequencing primer: GATGTTTCGGTAAGGGGTCC
• 3′ sequencing primer: CAGCCACCACCTTCTGATAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The zebrafish opitmized Cas9 coding sequence (nls-zcas9-nls) was obtained from Addgene plasmid pCS2-nCas9n (Plasmid #47929 Wenbiao Chen Lab).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry