Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGEM-HE-Venus-bPAC(F198Y)
(Plasmid #165487)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 165487 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEM HE
  • Backbone size w/o insert (bp) 3100
  • Total vector size (bp) 4936
  • Modifications to backbone
    pGEM-HE is a derivative of pGEM3Z vector(Promega) modified after Liman, E.R., Tytgat, J. & Hess,P.; Neuron 9, 1992
  • Vector type
    Bacterial Expression ; cDNA expression, Xenopus Oocyte

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Venus-bPAC(F198Y)-myc
  • Alt name
    Venus-bPAC(F198Y)
  • Species
    Synthetic; Beggiatoa
  • Insert Size (bp)
    1836
  • Promoter T7
  • Tags / Fusion Proteins
    • Myc (C terminal on insert)
    • Venus (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gaattaattcgagctcggtac
  • 3′ sequencing primer gtgtaagttggtattatgtag
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Plasmid was assembled in the lab of Georg Nagel

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEM-HE-Venus-bPAC(F198Y) was a gift from Thomas Oertner (Addgene plasmid # 165487 ; http://n2t.net/addgene:165487 ; RRID:Addgene_165487)
  • For your References section:

    PACmn for improved optogenetic control of intracellular cAMP. Yang S, Constantin OM, Sachidanandan D, Hofmann H, Kunz TC, Kozjak-Pavlovic V, Oertner TG, Nagel G, Kittel RJ, Gee CE, Gao S. BMC Biol. 2021 Oct 18;19(1):227. doi: 10.1186/s12915-021-01151-9. 10.1186/s12915-021-01151-9 PubMed 34663304