pGEM-HE-Glyco-Venus-bPAC(S27A)
(Plasmid
#165490)
-
PurposeXenopus oocyte expression of a photoactivatable adenylyl cyclase derived from bPAC using glycophorin for anchoring to the membrane with reduced dark activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165490 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEM HE
- Backbone size w/o insert (bp) 3009
- Total vector size (bp) 5301
-
Modifications to backbonepGEM-HE is a derivative of pGEM3Z vector(Promega) modified after Liman, E.R., Tytgat, J. & Hess,P.; Neuron 9, 1992
-
Vector typeBacterial Expression ; cDNA expression, Xenopus Oocyte
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGlyco-Venus-bPAC(S27A)-Myc
-
Alt nameGlyco-Venus-bPAC(S27A)
-
SpeciesSynthetic; Beggiatoa
-
Insert Size (bp)2292
- Promoter T7
-
Tags
/ Fusion Proteins
- Myc (C terminal on insert)
- Venus (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gaattaattcgagctcggtac
- 3′ sequencing primer gtgtaagttggtattatgtag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPlasmid was assembled in the lab of Georg Nagel
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEM-HE-Glyco-Venus-bPAC(S27A) was a gift from Thomas Oertner (Addgene plasmid # 165490 ; http://n2t.net/addgene:165490 ; RRID:Addgene_165490) -
For your References section:
PACmn for improved optogenetic control of intracellular cAMP. Yang S, Constantin OM, Sachidanandan D, Hofmann H, Kunz TC, Kozjak-Pavlovic V, Oertner TG, Nagel G, Kittel RJ, Gee CE, Gao S. BMC Biol. 2021 Oct 18;19(1):227. doi: 10.1186/s12915-021-01151-9. 10.1186/s12915-021-01151-9 PubMed 34663304