Skip to main content

SnFR-gamma8
(Plasmid #165496)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165496 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA 3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5460
  • Total vector size (bp) 8622
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    iGluSnFR extracellular domain fused to gamma-8 via NETO2 TM domain
  • Alt name
    cacng8
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    3162
  • Entrez Gene
    Cacng8
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BmgBI (unknown if destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer AACCGTATTCCACTGCTGC
  • 3′ sequencing primer CAACAGATGGCTGGCAACTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Susumu Tomita, Roger Nicoll, Lorin Looger

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Chimera of iGluSnFR (Addgene plasmid # 41732), Neto2 and Gamma-8.

Please visit https://doi.org/10.1101/2021.01.21.427382 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SnFR-gamma8 was a gift from Andrew Plested (Addgene plasmid # 165496 ; http://n2t.net/addgene:165496 ; RRID:Addgene_165496)
  • For your References section:

    Targeted sensors for glutamatergic neurotransmission. Hao Y, Toulme E, Konig B, Rosenmund C, Plested AJR. eLife. 2023 Jan 9;12:e84029. doi: 10.7554/eLife.84029. 10.7554/eLife.84029 PubMed 36622100