Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHN1_lacUV5-mNG-PDT
(Plasmid #165583)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 165583 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHN1_lacUV5
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mNeonGreen-PDT
  • Insert Size (bp)
    792
  • Promoter Ptrc
  • Tag / Fusion Protein
    • Protein degradation tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCGGGAATCGTAGCAAAGTC
  • 3′ sequencing primer ATCCCATATCACCAGCTCACCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHN1_lacUV5-mNG-PDT was a gift from Daniel Ducat (Addgene plasmid # 165583 ; http://n2t.net/addgene:165583 ; RRID:Addgene_165583)
  • For your References section:

    Orthogonal Degron System for Controlled Protein Degradation in Cyanobacteria. Sakkos JK, Hernandez-Ortiz S, Osteryoung KW, Ducat DC. ACS Synth Biol. 2021 Jul 16;10(7):1667-1681. doi: 10.1021/acssynbio.1c00035. Epub 2021 Jul 7. 10.1021/acssynbio.1c00035 PubMed 34232633