Level 1 P4 TaU6 guide acceptor
(Plasmid
#165600)
-
PurposeGoldenGate (MoClo) Level 1 Position 4 TaU6 guide acceptor plasmid
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165600 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC
-
Vector typeCRISPR, Synthetic Biology ; sgRNA acceptor with LacZ Blue/white screening
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTaU6 promoter::LacZ::sgRNA scaffold
-
gRNA/shRNA sequenceGTGAGACCGCAGCTGGCACG
-
SpeciesSynthetic
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains LacZ for blue/white screening
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Level 1 P4 TaU6 guide acceptor was a gift from Wendy Harwood & John Innes Centre - Wheat Transformation and Genome Editing (Addgene plasmid # 165600 ; http://n2t.net/addgene:165600 ; RRID:Addgene_165600) -
For your References section:
CRISPR-Cas9 Based Genome Editing in Wheat. Smedley MA, Hayta S, Clarke M, Harwood WA. Curr Protoc. 2021 Mar;1(3):e65. doi: 10.1002/cpz1.65. 10.1002/cpz1.65 PubMed 33687760