Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #166700)


Item Catalog # Description Quantity Price (USD)
Plasmid 166700 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5225
  • Total vector size (bp) 11782
  • Vector type
    Yeast Expression
  • Selectable markers
    G418 (kanMX6)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Gene/Insert 1

  • Gene/Insert name
    tRNA promoter : sgRNA cassette
  • Species
    S. pombe (fission yeast)
  • Insert Size (bp)
  • Promoter tRNA Ser promoter

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtaaaacgacggccagt
  • 3′ sequencing primer gtggaattgtgagcggataa
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    adh15 promoter : Cas9 codon-optimised for S. pombe
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
  • Promoter adh15 promoter

Cloning Information for Gene/Insert 2

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

The following acknowledgement must be included in all research publications and other outputs: “pLSB-KAN was created with the support of the Wellcome Trust [095021], [200885], [203149]”.

The following statement must be included on all submissions of original research to peer-reviewed journals: “pLSB-KAN was created with the support of the Wellcome Trust [095021], [200885], [203149]”.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLSB-KAN was a gift from Robin Allshire (Addgene plasmid # 166700 ; ; RRID:Addgene_166700)
  • For your References section:

    SpEDIT: A fast and efficient CRISPR/Cas9 method for fission yeast. Torres-Garcia S, Di Pompeo L, Eivers L, Gaborieau B, White SA, Pidoux AL, Kanigowska P, Yaseen I, Cai Y, Allshire RC. Wellcome Open Res. 2020 Nov 24;5:274. doi: 10.12688/wellcomeopenres.16405.1. eCollection 2020. 10.12688/wellcomeopenres.16405.1 PubMed 33313420