pLSB-NAT
(Plasmid
#166698)
-
PurposeCombined sgRNA/Cas9 pLSB vector with natMX6 (cloNAT) marker. Golden Gate-ready for cloning custom sgRNA sequences.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166698 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLSB
- Backbone size w/o insert (bp) 4988
- Total vector size (bp) 11545
-
Vector typeYeast Expression
-
Selectable markersNourseothricin (natMX6 - cloNAT)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nametRNA promoter : sgRNA cassette
-
SpeciesS. pombe (fission yeast)
-
Insert Size (bp)1393
- Promoter tRNA promoter
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gtaaaacgacggccagt (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameadh15 promoter : Cas9 codon-optimised for S. pombe
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)5164
- Promoter adh15 promoter
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCGCCCTCCTATTGGCTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The following acknowledgement must be included in all research publications and other outputs: “pLSB-NAT was created with the support of the Wellcome Trust [095021], [200885], [203149]”.
The following statement must be included on all submissions of original research to peer-reviewed journals: “pLSB-NAT was created with the support of the Wellcome Trust [095021], [200885], [203149]”.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLSB-NAT was a gift from Robin Allshire (Addgene plasmid # 166698 ; http://n2t.net/addgene:166698 ; RRID:Addgene_166698) -
For your References section:
SpEDIT: A fast and efficient CRISPR/Cas9 method for fission yeast. Torres-Garcia S, Di Pompeo L, Eivers L, Gaborieau B, White SA, Pidoux AL, Kanigowska P, Yaseen I, Cai Y, Allshire RC. Wellcome Open Res. 2020 Nov 24;5:274. doi: 10.12688/wellcomeopenres.16405.1. eCollection 2020. 10.12688/wellcomeopenres.16405.1 PubMed 33313420