Venus-tBid-pEGFP-C1
(Plasmid
#166736)
-
PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, tBid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166736 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametBid
-
Alt namep15 fragment of BH3-interacting domain death agonist protein, or Bcl2 like protein 10 (BCL2L10)
-
SpeciesM. musculus (mouse)
-
Entrez GeneBid (a.k.a. 2700049M22Rik)
- Promoter CMV
-
Tag
/ Fusion Protein
- Venus (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer TGACGCAAATGGGCGGTAGG
- 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bytBid seqence aligns with Mus musculus BH3 interacting domain death agonist (Bid), mRNA; NCBI Reference Sequence: NM_007544.4.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Transfection of this plasmid will express "VtBid" (Venus fused to the N-terminus of the BH3-only protein, truncated Bid (tBid)) in live cells. In cells, caspase 8 cleavage of Bid produces the p15 fragment, referred to as tBid. There is a 3 amino acid flexible linker between Venus and tBid proteins. When compared with EYFP, Venus fluorophore contains the following mutations: F46L, F64L, M153T, V163A and S175G. This Venus protein contains an F224R mutation to make it monomeric.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Venus-tBid-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 166736 ; http://n2t.net/addgene:166736 ; RRID:Addgene_166736) -
For your References section:
Bim escapes displacement by BH3-mimetic anti-cancer drugs by double-bolt locking both Bcl-XL and Bcl-2. Liu Q, Osterlund EJ, Chi X, Pogmore J, Leber B, Andrews DW. Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689. 10.7554/eLife.37689 PubMed 30860026