Skip to main content

mCerulean3-Mcl-1-pLVX
(Plasmid #166752)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166752 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLVX
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mcl-1
  • Alt name
    Bcl2 like protein 3 (Bcl2l3), Induced myeloid leukemia cell differentiation protein Mcl-1
  • Species
    H. sapiens (human)
  • Entrez Gene
    MCL1 (a.k.a. BCL2L3, EAT, MCL1-ES, MCL1L, MCL1S, Mcl-1, TM, bcl2-L-3, mcl1/EAT)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCerulean3 (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    mCerulean3 received from Mark Rizzo PMID: 21479270 and cloned into this plasmid. Mcl-1 sequence aligns with Homo sapiens MCL1 apoptosis regulator, BCL2 family member (MCL1), transcript variant 1, mRNA(NCBI Reference Sequence: NM_021960.5). The pLVX backbone from Addgene #115969 (Adrein Nougarede & David Andrews) was used and mCerulean3-Mcl1 was inserted.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

2nd generation lentiviral transfer plasmid that can be used to create lentivirus, for CMV driven expression of mCerulean3 fused to the N-terminus of Mcl-1. There is a flexible, 17 amino acid linker between mCerulean3 and Mcl-1. proteins.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCerulean3-Mcl-1-pLVX was a gift from David Andrews (Addgene plasmid # 166752 ; http://n2t.net/addgene:166752 ; RRID:Addgene_166752)
  • For your References section:

    Efficacy and specificity of inhibitors of BCL-2 family protein interactions assessed by affinity measurements in live cells. Osterlund EJ, Hirmiz N, Pemberton JM, Nougarede A, Liu Q, Leber B, Fang Q, Andrews DW. Sci Adv. 2022 Apr 22;8(16):eabm7375. doi: 10.1126/sciadv.abm7375. Epub 2022 Apr 20. 10.1126/sciadv.abm7375 PubMed 35442739