pIA1362
(Plasmid
#166860)
-
PurposeExpression of codon optimized SARS-COV-2 Nsp7 in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166860 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
- Total vector size (bp) 5724
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSARS-COV-2 Nsp7
-
SpeciesSynthetic
-
Insert Size (bp)523
-
GenBank ID
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter T7
-
Tag
/ Fusion Protein
- His-GB1 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIA1362 was a gift from Irina Artsimovitch (Addgene plasmid # 166860 ; http://n2t.net/addgene:166860 ; RRID:Addgene_166860) -
For your References section:
Allosteric Activation of SARS-CoV-2 RNA-Dependent RNA Polymerase by Remdesivir Triphosphate and Other Phosphorylated Nucleotides. Wang B, Svetlov V, Wolf YI, Koonin EV, Nudler E, Artsimovitch I. mBio. 2021 Jun 29;12(3):e0142321. doi: 10.1128/mBio.01423-21. Epub 2021 Jun 22. 10.1128/mBio.01423-21 PubMed 34154407