pTYF-sGFAP-IRES-tdTomato
(Plasmid
#166920)
-
Purpose(Empty Backbone) Empty plasmid backbone; includes IRES-tdTomato and sGFAP promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166920 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTYF
- Backbone size (bp) 12252
-
Vector typeMammalian Expression, Lentiviral
- Promoter sGFAP
-
Tag
/ Fusion Protein
- tdTomato (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer IRES forward (CCACTCATCTTATAGCTTTC)
- 3′ sequencing primer IRES reverse (CCAAGTCAGTGGCTGCAC)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTYF-sGFAP-IRES-tdTomato was a gift from Sergey Kasparov (Addgene plasmid # 166920 ; http://n2t.net/addgene:166920 ; RRID:Addgene_166920) -
For your References section:
Reducing l-lactate release from hippocampal astrocytes by intracellular oxidation increases novelty induced activity in mice. Vaccari Cardoso B, Shevelkin AV, Terrillion C, Mychko O, Mosienko V, Kasparov S, Pletnikov MV, Teschemacher AG. Glia. 2021 Jan 5. doi: 10.1002/glia.23960. 10.1002/glia.23960 PubMed 33400321