Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTYF-sGFAP-IRES-tdTomato
(Plasmid #166920)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 166920 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTYF
  • Backbone size (bp) 12252
  • Vector type
    Mammalian Expression, Lentiviral
  • Promoter sGFAP
  • Tag / Fusion Protein
    • tdTomato (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer IRES forward (CCACTCATCTTATAGCTTTC)
  • 3′ sequencing primer IRES reverse (CCAAGTCAGTGGCTGCAC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTYF-sGFAP-IRES-tdTomato was a gift from Sergey Kasparov (Addgene plasmid # 166920 ; http://n2t.net/addgene:166920 ; RRID:Addgene_166920)
  • For your References section:

    Reducing l-lactate release from hippocampal astrocytes by intracellular oxidation increases novelty induced activity in mice. Vaccari Cardoso B, Shevelkin AV, Terrillion C, Mychko O, Mosienko V, Kasparov S, Pletnikov MV, Teschemacher AG. Glia. 2021 Jan 5. doi: 10.1002/glia.23960. 10.1002/glia.23960 PubMed 33400321