Skip to main content

pET-28a_6H-MMLV_RT_D524N-6H
(Plasmid #166945)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166945 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-28a(+)
  • Backbone manufacturer
    Novagen (EMD Millipore)
  • Backbone size w/o insert (bp) 5369
  • Total vector size (bp) 7306
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Rosetta (DE3) strain for protein expression
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gag-pol
  • Alt name
    M-MLV Reverse Transcriptase
  • Alt name
    Pr180
  • Species
    Moloney murine leukemia virus
  • Insert Size (bp)
    2100
  • Mutation
    D524N, H8Y
  • GenBank ID
    2193424 AAC82568
  • Promoter T7
  • Tags / Fusion Proteins
    • 6X His (N terminal on backbone)
    • 6X His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer TAGTTATTGCTCAGCGGTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was found in our lab stocks. Its original source in not known.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-28a_6H-MMLV_RT_D524N-6H was a gift from Robert Tjian (Addgene plasmid # 166945 ; http://n2t.net/addgene:166945 ; RRID:Addgene_166945)
  • For your References section:

    Open-source RNA extraction and RT-qPCR methods for SARS-CoV-2 detection. Graham TGW, Dugast-Darzacq C, Dailey GM, Nguyenla XH, Van Dis E, Esbin MN, Abidi A, Stanley SA, Darzacq X, Tjian R. PLoS One. 2021 Feb 3;16(2):e0246647. doi: 10.1371/journal.pone.0246647. eCollection 2021. 10.1371/journal.pone.0246647 PubMed 33534838