Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-Syn1-FLEX-mCh-T2A-FLAG-hMOR-WPRE
(Plasmid #166970)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 166970 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-Syn1-FLEX-WPRE
  • Backbone manufacturer
    Vector Builder
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 6500
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Homo sapiens opioid receptor mu 1 (OPRM1)
  • Alt name
    hMOR
  • Alt name
    MOP
  • Alt name
    MOPR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2004
  • GenBank ID
    NM_000914.5 Gene ID 4988
  • Entrez Gene
    OPRM1 (a.k.a. LMOR, M-OR-1, MOP, MOR, MOR1, OPRM)
  • Promoter hsyn
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • T2A (N terminal on insert)
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer GCGTAAAAGGAGCAACATAGTTAAGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vector Builder

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Syn1-FLEX-mCh-T2A-FLAG-hMOR-WPRE was a gift from Matthew Banghart (Addgene plasmid # 166970 ; http://n2t.net/addgene:166970 ; RRID:Addgene_166970)
  • For your References section:

    Neural basis of opioid-induced respiratory depression and its rescue. Liu S, Kim DI, Oh TG, Pao GM, Kim JH, Palmiter RD, Banghart MR, Lee KF, Evans RM, Han S. Proc Natl Acad Sci U S A. 2021 Jun 8;118(23). pii: 2022134118. doi: 10.1073/pnas.2022134118. 10.1073/pnas.2022134118 PubMed 34074761