FASTHDR-tRNApromo-sgRNA-espCas91_1
(Plasmid
#167210)
-
Purpose(Empty Backbone) Plasmid for easy cloning of a sgRNA sequence. The Plasmid contain a tRNA promoter to facilitate the expression of any sgRNA sequence and also expresses eSpCas9(1.1)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneeSpCas9(1.1) (Addgene Plasmid #71814)
-
Vector typeMammalian Expression, CRISPR
- Promoter CMV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Growth instructionsThe empty plasmid must be maintained in E.coli DB3.1 or other ccdb resistant strain. Once the plasmid is used to insert an sgRNA sequence, the plasmid must be transformed in a strain that is sensitive to ccdb such as DH5Alpha or similar.
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcgtcgatttttgtgatgct (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FASTHDR-tRNApromo-sgRNA-espCas91_1 was a gift from Oscar Perez (Addgene plasmid # 167210 ; http://n2t.net/addgene:167210 ; RRID:Addgene_167210) -
For your References section:
Multiplex Gene Tagging with CRISPR-Cas9 for Live-Cell Microscopy and Application to Study the Role of SARS-CoV-2 Proteins in Autophagy, Mitochondrial Dynamics, and Cell Growth. Perez-Leal O, Nixon-Abell J, Barrero CA, Gordon JC, Oesterling J, Rico MC. CRISPR J. 2021 Nov 30. doi: 10.1089/crispr.2021.0041. 10.1089/crispr.2021.0041 PubMed 34847745