pDS1902
(Plasmid
#167278)
-
PurposeExpression plasmid for Candida albicans containing a red-shifted firefly luciferase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167278 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBluescript
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namered shifted luciferase
-
SpeciesSynthetic
-
Insert Size (bp)1653
- Promoter ACT1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer AATTAACCCTCACTAAAGGG
- 3′ sequencing primer CGTTCTTAATACTAACATAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDS1902 was a gift from Dominique Sanglard (Addgene plasmid # 167278 ; http://n2t.net/addgene:167278 ; RRID:Addgene_167278) -
For your References section:
Red-Shifted Firefly Luciferase Optimized for Candida albicans In vivo Bioluminescence Imaging. Dorsaz S, Coste AT, Sanglard D. Front Microbiol. 2017 Aug 3;8:1478. doi: 10.3389/fmicb.2017.01478. eCollection 2017. 10.3389/fmicb.2017.01478 PubMed 28824601