Skip to main content

pJAK080
(Plasmid #167279)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167279 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMTLSC-7315
  • Backbone manufacturer
    Nigel P Minton
  • Backbone size (bp) 6000
  • Modifications to backbone
    C. difficile mreB2 was PCR amplified using oligonucleotides RF627 (GATCGAGCTCAGAATGTTTTAAACATGATTCTTAATAGTA) and RF628 (GATCGGATCCCTAATTCTTAGTATTCATCATTAATACTTTTTC) and inserted downstream of Ptet in pRPF185 (doi:10.1074/jbc.M111.263889) using SacI/BamHI restriction-ligation. Ptet-mreB2 and homology arms upstream and downstream of the genome insertion site were amplified by PCR using oligonucleotides RF839 (TTAGGGATGTAATAACGAATTCTGCATCAAGCTAG) and RF840 (TAAATAATTAAGTTTAAATAAAAAAGACTTCTCATGAGAG), RF837 (CGTAGAAATACGGTGTTTTTTGTTACCCTAAATATATCTTGCCCAAATGTC) and RF838 (TTGATGCAGAATTCGTTATTACATCCCTAATTCCTTG), and RF841 (AAGTCTTTTTTATTTAAACTTAATTATTTATAGTGTTACTTAAAAAATG) and RF842 (GGGATTTTGGTCATGAGATTATCAAAAAGGATAGTATATAACATTAATAAAATTTAAAATCAATAATTAT) respectively. The three resulting fragments were assembled by Gibson assembly into pMTLSC7315 (doi:10.1128/AEM.00249-12), linearised by PCR using oligonucleotides RF311 (TAGGGTAACAAAAAACACCG) and RF312 (CCTTTTTGATAATCTCATGACC). Extraneous BamHI, SacI, and KpnI restriction sites in the plasmid backbone were removed by inverse PCR cloning (RF851, CTAGAGTCGACGTCACGCG/RF852, GAATTCGCCCTTTAAACTAAGCTC), resulting in pJAK080.
  • Vector type
    E. coli - C. difficile shuttle vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Low copy in C. difficile following conjugation and selected with thiamphenicol
  • Copy number
    High Copy

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJAK080 was a gift from Robert Fagan (Addgene plasmid # 167279 ; http://n2t.net/addgene:167279 ; RRID:Addgene_167279)
  • For your References section:

    An RNA-centric global view of Clostridioides difficile reveals broad activity of Hfq in a clinically important gram-positive bacterium. Fuchs M, Lamm-Schmidt V, Sulzer J, Ponath F, Jenniches L, Kirk JA, Fagan RP, Barquist L, Vogel J, Faber F. Proc Natl Acad Sci U S A. 2021 Jun 22;118(25). pii: 2103579118. doi: 10.1073/pnas.2103579118. 10.1073/pnas.2103579118 PubMed 34131082
Commonly requested with: