pJAK080
(Plasmid
#167279)
-
Purpose(Empty Backbone) CodA-based vector for insertion of DNA by recombination downstream of the pyrE gene in C. difficile
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167279 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMTLSC-7315
-
Backbone manufacturerNigel P Minton
- Backbone size (bp) 6000
-
Modifications to backboneC. difficile mreB2 was PCR amplified using oligonucleotides RF627 (GATCGAGCTCAGAATGTTTTAAACATGATTCTTAATAGTA) and RF628 (GATCGGATCCCTAATTCTTAGTATTCATCATTAATACTTTTTC) and inserted downstream of Ptet in pRPF185 (doi:10.1074/jbc.M111.263889) using SacI/BamHI restriction-ligation. Ptet-mreB2 and homology arms upstream and downstream of the genome insertion site were amplified by PCR using oligonucleotides RF839 (TTAGGGATGTAATAACGAATTCTGCATCAAGCTAG) and RF840 (TAAATAATTAAGTTTAAATAAAAAAGACTTCTCATGAGAG), RF837 (CGTAGAAATACGGTGTTTTTTGTTACCCTAAATATATCTTGCCCAAATGTC) and RF838 (TTGATGCAGAATTCGTTATTACATCCCTAATTCCTTG), and RF841 (AAGTCTTTTTTATTTAAACTTAATTATTTATAGTGTTACTTAAAAAATG) and RF842 (GGGATTTTGGTCATGAGATTATCAAAAAGGATAGTATATAACATTAATAAAATTTAAAATCAATAATTAT) respectively. The three resulting fragments were assembled by Gibson assembly into pMTLSC7315 (doi:10.1128/AEM.00249-12), linearised by PCR using oligonucleotides RF311 (TAGGGTAACAAAAAACACCG) and RF312 (CCTTTTTGATAATCTCATGACC). Extraneous BamHI, SacI, and KpnI restriction sites in the plasmid backbone were removed by inverse PCR cloning (RF851, CTAGAGTCGACGTCACGCG/RF852, GAATTCGCCCTTTAAACTAAGCTC), resulting in pJAK080.
-
Vector typeE. coli - C. difficile shuttle vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLow copy in C. difficile following conjugation and selected with thiamphenicol
-
Copy numberHigh Copy
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJAK080 was a gift from Robert Fagan (Addgene plasmid # 167279 ; http://n2t.net/addgene:167279 ; RRID:Addgene_167279) -
For your References section:
An RNA-centric global view of Clostridioides difficile reveals broad activity of Hfq in a clinically important gram-positive bacterium. Fuchs M, Lamm-Schmidt V, Sulzer J, Ponath F, Jenniches L, Kirk JA, Fagan RP, Barquist L, Vogel J, Faber F. Proc Natl Acad Sci U S A. 2021 Jun 22;118(25). pii: 2103579118. doi: 10.1073/pnas.2103579118. 10.1073/pnas.2103579118 PubMed 34131082