pJAK112
(Plasmid
#167280)
-
Purpose(Empty Backbone) CodA-based mutagenesis vector for C. difficile
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMTLSC-7215
-
Backbone manufacturerNigel P Minton
- Backbone size (bp) 6768
-
Modifications to backboneBamHI, SacI, and KpnI restriction sites were first removed from pMTLSC-7215 (doi:10.1128/AEM.00249-12) by inverse PCR cloning (RF851, CTAGAGTCGACGTCACGCG/RF852, GAATTCGCCCTTTAAACTAAGCTC). The resulting plasmid was linearised by PCR using oligonucleotides RF1065 (GATCGAGCTCTAGGGTAACAAAAAACACCG) and RF1066 (GATCGGATCCCCTTTTTGATAATCTCATGACC), adding new terminal SacI and BamHI sites. Homology arms upstream and downstream of the slpA gene were amplified using oligonucleotides RF1025 (TATATTATTATATTTATACCCAAGCATATGAGTTTTTATAC) / RF1067 (GATCGAGCTCTATACAGGTGAAGCAGATGC) and RF1026 (ACTCATATGCTTGGGTATAAATATAATAATATAAAAAGGCTTCTTATATG ) / RF1068 (GATCGGATCCCTCTTCCTGTAAATTCGTCAAC), respectively, joined by SOEing PCR and combined with the linearised vector by SacI/BamHI restriction ligation resulting in pJAK112.
-
Vector typeE. coli - C. difficile shuttle vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLow copy in C. difficile following conjugation and selected with thiamphenicol
-
Copy numberHigh Copy
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJAK112 was a gift from Robert Fagan (Addgene plasmid # 167280 ; http://n2t.net/addgene:167280 ; RRID:Addgene_167280) -
For your References section:
An RNA-centric global view of Clostridioides difficile reveals broad activity of Hfq in a clinically important gram-positive bacterium. Fuchs M, Lamm-Schmidt V, Sulzer J, Ponath F, Jenniches L, Kirk JA, Fagan RP, Barquist L, Vogel J, Faber F. Proc Natl Acad Sci U S A. 2021 Jun 22;118(25). pii: 2103579118. doi: 10.1073/pnas.2103579118. 10.1073/pnas.2103579118 PubMed 34131082