pSpCas9nucl-T2A-EGFP - BAXgRNA1- BAXgRNA2
(Plasmid
#167296)
-
PurposePlasmid encoding for 2 gRNAs targeting the human BAX gene and a CMV driven nuclease Cas9 followed by self-cleaving EGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167296 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePX458
- Total vector size (bp) 9720
-
Modifications to backboneInserted a second U6 gRNA expression cassette
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBAX
-
gRNA/shRNA sequenceGCTGCAGGATGATTGCCGCCG, GTCTGACGGCAACTTCAACTG
-
SpeciesH. sapiens (human)
-
Entrez GeneBAX (a.k.a. BCL2L4)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.01.31.929075v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9nucl-T2A-EGFP - BAXgRNA1- BAXgRNA2 was a gift from Agnel Sfeir (Addgene plasmid # 167296 ; http://n2t.net/addgene:167296 ; RRID:Addgene_167296) -
For your References section:
Nuclear sensing of breaks in mitochondrial DNA enhances immune surveillance. Tigano M, Vargas DC, Tremblay-Belzile S, Fu Y, Sfeir A. Nature. 2021 Mar;591(7850):477-481. doi: 10.1038/s41586-021-03269-w. Epub 2021 Feb 24. 10.1038/s41586-021-03269-w PubMed 33627873