Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

SOX2 KO (T2A-H2B-EGFP)
(Plasmid #167969)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 167969 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SRY-Box Transcription Factor 2
  • Species
    H. sapiens (human)
  • Mutation
    homology arms contain point mutations to disrupt crRNA binding sites used and point mutations specific to WTC genome
  • Entrez Gene
    SOX2 (a.k.a. ANOP3, MCOPS3)
  • Tag / Fusion Protein
    • H2B-EGFP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gatgtgctgcaaggcgattaag
  • 3′ sequencing primer ctcgtatgttgtgtggaattg
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SOX2 KO (T2A-H2B-EGFP) was a gift from Emma Rawlins (Addgene plasmid # 167969 ; http://n2t.net/addgene:167969 ; RRID:Addgene_167969)
  • For your References section:

    A functional genetic toolbox for human tissue-derived organoids. Sun D, Evans L, Perrone F, Sokleva V, Lim K, Rezakhani S, Lutolf M, Zilbauer M, Rawlins EL. Elife. 2021 Oct 6;10. pii: 67886. doi: 10.7554/eLife.67886. 10.7554/eLife.67886 PubMed 34612202