Skip to main content

pMEH380 VSV-G HA
(Plasmid #168222)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 168222 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA 3.1+ Hygro
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6097
  • Total vector size (bp) 7681
  • Modifications to backbone
    Contains beta-globin intron upstream of insert
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VSV-G
  • Species
    Vesicular Stomatitis Virus
  • Insert Size (bp)
    1584
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site N/A (unknown if destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CMVF CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer BGHR TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    VSV-G DNA purchased from Clontech

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMEH380 VSV-G HA was a gift from Joshua Leonard (Addgene plasmid # 168222 ; http://n2t.net/addgene:168222 ; RRID:Addgene_168222)
  • For your References section:

    A platform for actively loading cargo RNA to elucidate limiting steps in EV-mediated delivery. Hung ME, Leonard JN. J Extracell Vesicles. 2016 May 13;5:31027. doi: 10.3402/jev.v5.31027. eCollection 2016. PubMed 27189348