pMEH380 VSV-G HA
(Plasmid
#168222)
-
PurposeMammalian expression of vesicular stomatitis virus glycoprotein fused to a C-terminal HA tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168222 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
This item is currently unavailable outside the US without additional regulatory approval.
A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.
Backbone
-
Vector backbonepcDNA 3.1+ Hygro
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6097
- Total vector size (bp) 7681
-
Modifications to backboneContains beta-globin intron upstream of insert
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVSV-G
-
SpeciesVesicular Stomatitis Virus
-
Insert Size (bp)1584
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site N/A (unknown if destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CMVF CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer BGHR TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byVSV-G DNA purchased from Clontech
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMEH380 VSV-G HA was a gift from Joshua Leonard (Addgene plasmid # 168222 ; http://n2t.net/addgene:168222 ; RRID:Addgene_168222) -
For your References section:
A platform for actively loading cargo RNA to elucidate limiting steps in EV-mediated delivery. Hung ME, Leonard JN. J Extracell Vesicles. 2016 May 13;5:31027. doi: 10.3402/jev.v5.31027. eCollection 2016. PubMed 27189348