Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Tol2-LyzC-GFP-U6ac-cdk2-guides
(Plasmid #168250)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 168250 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    R4R3 pDest
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    cdk2 sgRNAs
  • gRNA/shRNA sequence
    agagacggtcgacagtctgcagtgtcgtctctc
  • Species
    D. rerio (zebrafish)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tol2-LyzC-GFP-U6ac-cdk2-guides was a gift from Qing Deng (Addgene plasmid # 168250 ; http://n2t.net/addgene:168250 ; RRID:Addgene_168250)
  • For your References section:

    A robust and flexible CRISPR/Cas9-based system for neutrophil-specific gene inactivation in zebrafish. Wang Y, Hsu AY, Walton EM, Park SJ, Syahirah R, Wang T, Zhou W, Ding C, Lemke AP, Zhang G, Tobin DM, Deng Q. J Cell Sci. 2021 Apr 15;134(8). pii: 237799. doi: 10.1242/jcs.258574. Epub 2021 Apr 22. 10.1242/jcs.258574 PubMed 33722979