CSAC-Bmal1
(Plasmid
#168296)
-
PurposeExpresses sgRNA in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168296 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-hU6-gRNA-hSyn-mCherry-KASH
- Backbone size w/o insert (bp) 5294
- Total vector size (bp) 5653
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehU6-sgBmal1-1-hU6-sgBmal1-3
-
Alt nameCSAC-Bmal1
-
gRNA/shRNA sequenceGGAACCGGAGAGTAGGTCGG, GCCTCTTTTCAATCTGACTG
-
SpeciesM. musculus (mouse)
- Promoter U6, hSyn
-
Tag
/ Fusion Protein
- mCherry (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (not destroyed)
- 5′ sequencing primer pUC_F ggagcctatggaaaaacgccag
- 3′ sequencing primer hSyn_R gtcggtcgtcaggtaggcac
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
When comparing to the depositor reference sequence, please note that the mutations K14E, N210D, and E249G in mCherry-KASH do not alter plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CSAC-Bmal1 was a gift from Han Kyoung Choe (Addgene plasmid # 168296 ; http://n2t.net/addgene:168296 ; RRID:Addgene_168296) -
For your References section:
Multiplexed CRISPR-Cas9 system in a single adeno-associated virus to simultaneously knock out redundant clock genes. Kim B, Kim J, Chun M, Park I, Kwak D, Choi M, Kim K, Choe HK. Sci Rep. 2021 Jan 28;11(1):2575. doi: 10.1038/s41598-021-82287-0. 10.1038/s41598-021-82287-0 PubMed 33510438