pLM1110_LEU2
(Plasmid
#168460)
-
PurposeBig-IN Payload yeast assembly vector. Encodes LEU2 yeast selectable marker and components for bacterial copy number induction. Contains a mammalian transient (backbone) GFP-T2A-BSD selection cassette.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168460 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonecustom
-
Backbone manufacturerMaurano and Boeke labs, The Center for Synthetic Regulatory Genomics, NYU Langone Health
-
Vector typeSynthetic Biology ; Yeast assembly vector for Big-IN payloads
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)TransforMax EPI300
-
Growth instructionsCopy number induction is recommended for high yield preps. See Lucigen’s growth and copy number induction protocol for TransforMax EPI300 cells.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemRFP1
-
Insert Size (bp)678
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGATCTCGCCCCGAGAACTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLM1110_LEU2 was a gift from Jef Boeke (Addgene plasmid # 168460 ; http://n2t.net/addgene:168460 ; RRID:Addgene_168460) -
For your References section:
A versatile platform for locus-scale genome rewriting and verification. Brosh R, Laurent JM, Ordonez R, Huang E, Hogan MS, Hitchcock AM, Mitchell LA, Pinglay S, Cadley JA, Luther RD, Truong DM, Boeke JD, Maurano MT. Proc Natl Acad Sci U S A. 2021 Mar 9;118(10). pii: 2023952118. doi: 10.1073/pnas.2023952118. 10.1073/pnas.2023952118 PubMed 33649239