Skip to main content

cpLOV2-V7
(Plasmid #168993)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168993 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    mCherry2-N1
  • Backbone size w/o insert (bp) 4728
  • Total vector size (bp) 5166
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cpLOV2-V7
  • Insert Size (bp)
    438
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CMVf: CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cpLOV2-V7 was a gift from Yubin Zhou (Addgene plasmid # 168993 ; http://n2t.net/addgene:168993 ; RRID:Addgene_168993)
  • For your References section:

    Circularly permuted LOV2 as a modular photoswitch for optogenetic engineering. He L, Tan P, Zhu L, Huang K, Nguyen NT, Wang R, Guo L, Li L, Yang Y, Huang Z, Huang Y, Han G, Wang J, Zhou Y. Nat Chem Biol. 2021 Aug;17(8):915-923. doi: 10.1038/s41589-021-00792-9. Epub 2021 May 6. 10.1038/s41589-021-00792-9 PubMed 33958793