Skip to main content

pB[U6-3 wex2 PUb-DsRed]
(Plasmid #169010)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169010 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMS1425 p10
  • Total vector size (bp) 7618
  • Vector type
    Insect Expression ; piggyBac

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    white ex2 sgRNA
  • Species
    Drosophila suzukii
  • Promoter Drosophila melanogaster U6:3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer CGCCAAAACCAAATCTGCC
  • 3′ sequencing primer GCTTGTCAATGCGGTAAGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    CFD3 source of the U6:3 promoter/terminator from Addgene, #49410

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pB[U6-3 wex2 PUb-DsRed] was a gift from Max Scott (Addgene plasmid # 169010 ; http://n2t.net/addgene:169010 ; RRID:Addgene_169010)
  • For your References section:

    Genetically Encoded CRISPR Components Yield Efficient Gene Editing in the Invasive Pest Drosophila suzukii. Kandul NP, Belikoff EJ, Liu J, Buchman A, Li F, Yamamoto A, Yang T, Shriner I, Scott MJ, Akbari OS. CRISPR J. 2021 Oct;4(5):739-751. doi: 10.1089/crispr.2021.0032. 10.1089/crispr.2021.0032 PubMed 34661429