pB[U6-3 wex2 PUb-DsRed]
(Plasmid
#169010)
-
PurposeFor germline transformation. Expresses white exon 2 sgRNA and DsRed marker in all cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169010 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMS1425 p10
- Total vector size (bp) 7618
-
Vector typeInsect Expression ; piggyBac
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namewhite ex2 sgRNA
-
SpeciesDrosophila suzukii
- Promoter Drosophila melanogaster U6:3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer CGCCAAAACCAAATCTGCC
- 3′ sequencing primer GCTTGTCAATGCGGTAAGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCFD3 source of the U6:3 promoter/terminator from Addgene, #49410
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB[U6-3 wex2 PUb-DsRed] was a gift from Max Scott (Addgene plasmid # 169010 ; http://n2t.net/addgene:169010 ; RRID:Addgene_169010) -
For your References section:
Genetically Encoded CRISPR Components Yield Efficient Gene Editing in the Invasive Pest Drosophila suzukii. Kandul NP, Belikoff EJ, Liu J, Buchman A, Li F, Yamamoto A, Yang T, Shriner I, Scott MJ, Akbari OS. CRISPR J. 2021 Oct;4(5):739-751. doi: 10.1089/crispr.2021.0032. 10.1089/crispr.2021.0032 PubMed 34661429