Skip to main content

pB[nos-Cas9 PUb-ZsGreen]
(Plasmid #169011)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169011 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pB[PUb-ZsGreen]
  • Total vector size (bp) 7627
  • Vector type
    Insect Expression ; piggyBac

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4163
  • Promoter Drosophila melanogaster nanos

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HapI (destroyed during cloning)
  • 3′ cloning site PspOMI (not destroyed)
  • 5′ sequencing primer CGCCAAAACCAAATCTGCC
  • 3′ sequencing primer GCTTGTCAATGCGGTAAGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    nos_cas9 from NIG-Fly, Japan. We moved the nos-Cas9 gene into a piggyBac vector

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pB[nos-Cas9 PUb-ZsGreen] was a gift from Max Scott (Addgene plasmid # 169011 ; http://n2t.net/addgene:169011 ; RRID:Addgene_169011)
  • For your References section:

    Genetically Encoded CRISPR Components Yield Efficient Gene Editing in the Invasive Pest Drosophila suzukii. Kandul NP, Belikoff EJ, Liu J, Buchman A, Li F, Yamamoto A, Yang T, Shriner I, Scott MJ, Akbari OS. CRISPR J. 2021 Oct;4(5):739-751. doi: 10.1089/crispr.2021.0032. 10.1089/crispr.2021.0032 PubMed 34661429