GFP-Rab9aQ66L
(Plasmid
#169072)
-
PurposeExpress human constitutively active form of Rab9a(Q66L) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169072 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAcGFP1-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5298
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab9a
-
SpeciesH. sapiens (human)
-
Insert Size (bp)610
-
MutationQ66L
-
GenBank IDNM_004251.5
-
Entrez GeneRAB9A (a.k.a. RAB9)
- Promoter CMV
-
Tag
/ Fusion Protein
- acGFP1 (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-Rab9aQ66L was a gift from Gia Voeltz (Addgene plasmid # 169072 ; http://n2t.net/addgene:169072 ; RRID:Addgene_169072) -
For your References section:
Reticulon-3 Promotes Endosome Maturation at ER Membrane Contact Sites. Wu H, Voeltz GK. Dev Cell. 2021 Jan 11;56(1):52-66.e7. doi: 10.1016/j.devcel.2020.12.014. 10.1016/j.devcel.2020.12.014 PubMed 33434526