Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

10xHis-TEV-ATG5_ATG7_ATG10_ATG12_ATG16L1-TEV-mGFP-StrepII (Human autophagy E3(mGFP)-like enzyme)
(Plasmid #169077)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 169077 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGBdest
  • Backbone manufacturer
    Vienna Biocenter Core Facilities GmbH, Vienna, Austria (Protech)
  • Backbone size w/o insert (bp) 4958
  • Total vector size (bp) 12834
  • Vector type
    Bacterial Expression, Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin and Gentamicin, 50 & 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    ATG5
  • Alt name
    ASP; APG5; APG5L; hAPG5; SCAR25; APG5-LIKE
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    894
  • GenBank ID
    9474 NC_000006.12
  • Promoter Polyhedrin promoter
  • Tag / Fusion Protein
    • HIS10 Tag, TEV cleavage site (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GGCGGTGAAAACCTGTATTTC
  • 3′ sequencing primer TTAGTCCGTAGGTTGGGGAAT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ATG7
  • Alt name
    GSA7; APG7L; APG7-LIKE
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2112
  • GenBank ID
    10533 NC_000003.12
  • Promoter Polyhedrin promoter

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGGCAGCGGCTACTGGTGAC
  • 3′ sequencing primer AGCGACGATGAGACTATTTAA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    ATG10
  • Alt name
    APG10; APG10L; pp12616
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    663
  • GenBank ID
    83734 NC_000005.10
  • Entrez Gene
    ATG10 (a.k.a. APG10, APG10L, pp12616)
  • Promoter Polyhedrin promoter

Cloning Information for Gene/Insert 3

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGGAGGAGGACGAGTTCATC
  • 3′ sequencing primer TTAGGGCACGTTTCTTTCGTC
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    ATG12
  • Alt name
    APG12; FBR93; APG12L; HAPG12
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    423
  • GenBank ID
    9140 NC_000005.10
  • Promoter Polyhedrin promoter

Cloning Information for Gene/Insert 4

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGGCCGAAGAGCCCCAGAGC
  • 3′ sequencing primer TTAGCCCCACGCTTGTGATTT
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    ATG16
  • Alt name
    IBD10; WDR30; APG16L; ATG16A; ATG16L
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1881
  • GenBank ID
    55054 NC_000002.12
  • Entrez Gene
    ATG16L1 (a.k.a. APG16L, ATG16A, ATG16L, IBD10, WDR30)
  • Promoter Polyhedrin promoter
  • Tag / Fusion Protein
    • GFP tag, GGlinker, TEV cleavage site. StrepII (C terminal on insert)

Cloning Information for Gene/Insert 5

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGAGCAGCGGTTTGAGGGCG
  • 3′ sequencing primer GCGGTGCTCTGGGCTCAATAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Internal construct reference: SMC-1100

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    10xHis-TEV-ATG5_ATG7_ATG10_ATG12_ATG16L1-TEV-mGFP-StrepII (Human autophagy E3(mGFP)-like enzyme) was a gift from Sascha Martens (Addgene plasmid # 169077 ; http://n2t.net/addgene:169077 ; RRID:Addgene_169077)
  • For your References section:

    A PI3K-WIPI2 positive feedback loop allosterically activates LC3 lipidation in autophagy. Fracchiolla D, Chang C, Hurley JH, Martens S. J Cell Biol. 2020 Jul 6;219(7). pii: 151802. doi: 10.1083/jcb.201912098. 10.1083/jcb.201912098 PubMed 32437499