pK27Sumo_His-SUMO-nsp10-nsp14 fusion (SARS-CoV-2)
(Plasmid
#169161)
-
PurposeTo express nsp10-nsp14 fusion protein in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169161 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepK27SUMO
- Total vector size (bp) 6307
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsT5 promoter inducible with IPTG
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name14His-SUMO-nsp10-GGSGGS-nsp14
-
Alt namensp10-14 fusion protein
-
Alt nameSARS-CoV-2 nsp14/nsp10 exonuclease/methyltransferase
-
SpeciesSynthetic; SARS-CoV-2
-
MutationCodon optimised for E. coli
-
GenBank ID
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter T5
-
Tags
/ Fusion Proteins
- 14His-SUMO (N terminal on backbone)
- Fusion protein of SARS-CoV-2 nsp10 and nsp14 connected with a GGSGGS linker
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAAGCTGATCAGACCCCTGA
- 3′ sequencing primer CCAGATGGAGTTCTGAGGTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pK27Sumo_His-SUMO-nsp10-nsp14 fusion (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169161 ; http://n2t.net/addgene:169161 ; RRID:Addgene_169161) -
For your References section:
Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of nsp14/nsp10 exoribonuclease. Canal B, McClure AW, Curran JF, Wu M, Ulferts R, Weissmann F, Zeng J, Bertolin AP, Milligan JC, Basu S, Drury LS, Deegan TD, Fujisawa R, Roberts EL, Basier C, Labib K, Beale R, Howell M, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2445-2464. doi: 10.1042/BCJ20210198. 10.1042/BCJ20210198 PubMed 34198326