p414GPD-3xFLAG-Nop4 WT
(Plasmid
#169261)
-
PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 WT
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169261 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep414GPD
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNop4 WT
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneNOP4 (a.k.a. NOP77)
- Promoter GPD
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GACGGTAGGTATTGATTGTAATTCTGT
- 3′ sequencing primer TTCGGTTAGAGCGGATGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p414GPD-3xFLAG-Nop4 WT was a gift from Susan Baserga (Addgene plasmid # 169261 ; http://n2t.net/addgene:169261 ; RRID:Addgene_169261) -
For your References section:
Biallelic splicing variants in the nucleolar 60S assembly factor RBM28 cause the ribosomopathy ANE syndrome. Bryant CJ, Lorea CF, de Almeida HL Jr, Weinert L, Vedolin L, Pinto E Vairo F, Baserga SJ. Proc Natl Acad Sci U S A. 2021 May 11;118(19). pii: 2017777118. doi: 10.1073/pnas.2017777118. 10.1073/pnas.2017777118 PubMed 33941690