pDisplay-ZIBG2
(Plasmid
#169458)
-
Purposecell surface localized zinc sensor with ~ 300 nM Kd
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169458 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDisplay
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameZIBG2
-
SpeciesSynthetic
-
Insert Size (bp)825
-
GenBank IDMK673552
-
Tag
/ Fusion Protein
- pDisplay backbone elements for export and membrane anchor
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
When selecting zinc biosensors for your particular application, please pay attention to the Kd. The Kd of the sensor has to match the concentration range of your particular experiments.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDisplay-ZIBG2 was a gift from Huiwang Ai (Addgene plasmid # 169458 ; http://n2t.net/addgene:169458 ; RRID:Addgene_169458) -
For your References section:
Genetically Encoded, Photostable Indicators to Image Dynamic Zn(2+) Secretion of Pancreatic Islets. Chen M, Zhang S, Xing Y, Li X, He Y, Wang Y, Oberholzer J, Ai HW. Anal Chem. 2019 Oct 1;91(19):12212-12219. doi: 10.1021/acs.analchem.9b01802. Epub 2019 Sep 10. 10.1021/acs.analchem.9b01802 PubMed 31475537