Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pgRNAkan-glpR
(Plasmid #169873)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 169873 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBBR1k-GFP
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sgRNA towards glpR in Pseudomonas putida
  • gRNA/shRNA sequence
    ggccggggttggtgtccggt
  • Species
    Synthetic

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pgRNAkan-glpR was a gift from Brian Pfleger (Addgene plasmid # 169873 ; http://n2t.net/addgene:169873 ; RRID:Addgene_169873)
  • For your References section:

    Stepwise genetic engineering of Pseudomonas putida enables robust heterologous production of prodigiosin and glidobactin A. Cook TB, Jacobson TB, Venkataraman MV, Hofstetter H, Amador-Noguez D, Thomas MG, Pfleger BF. Metab Eng. 2021 Jun 24;67:112-124. doi: 10.1016/j.ymben.2021.06.004. 10.1016/j.ymben.2021.06.004 PubMed 34175462