Hsp68-LacZ-Gibson
(Plasmid
#170102)
-
Purpose(Empty Backbone) Transgenic LacZ reporter construct for validation of enhancer sequences (inserted via Gibson-cloning). Can be introduced into the mouse genome via random integration following pro-nuclear injection.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170102 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneNA
- Backbone size (bp) 7100
-
Vector typeMouse Targeting
- Promoter Mouse Hsp68 minimal promoter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTGAGCGGATAACAATTTCAC
- 3′ sequencing primer CTCAGTTTGGATGTTCCTGGAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byA portion of this plasmid was derived from a plasmid developed in the lab of Janet Rossant (Kothary et al., 1989 (PMID: 2557196)).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is a modified version of the Hsp68-LacZ-Gateway vector (Addgene Plasmid #37843).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hsp68-LacZ-Gibson was a gift from Len Pennacchio (Addgene plasmid # 170102 ; http://n2t.net/addgene:170102 ; RRID:Addgene_170102)