Skip to main content

Hsp68-LacZ-Gibson
(Plasmid #170102)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170102 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    NA
  • Backbone size (bp) 7100
  • Vector type
    Mouse Targeting
  • Promoter Mouse Hsp68 minimal promoter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGTGAGCGGATAACAATTTCAC
  • 3′ sequencing primer CTCAGTTTGGATGTTCCTGGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is a modified version of the Hsp68-LacZ-Gateway vector (Addgene Plasmid #37843).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hsp68-LacZ-Gibson was a gift from Len Pennacchio (Addgene plasmid # 170102 ; http://n2t.net/addgene:170102 ; RRID:Addgene_170102)