Circular 200,100 (mIDUA)
(Plasmid
#170123)
-
PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promoters
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170123 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepZac2.1
-
Backbone manufacturerAddgene #78601
- Backbone size w/o insert (bp) 5700
- Total vector size (bp) 6000
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCircular 200,100 guide RNA
-
gRNA/shRNA sequenceGCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGCCTAACCATGCCGACTGATGGCAGAAAAAAAAAAACTCCAGGCCGCTGCGGAGCCTTCAGGGTGATGGGTGCTGGCCAGGACACCCACTGTATGATTGCTGTCCAACACAGCCCCAGCCTTTGAGACCTCTGCCCAGAGTTGTTCTCCATCCAACAGGGCCATGAGCCCCATGACTGTGAGTACTGGCTTTCGCAGCAACTGCACGTGGGGTGGGTGAGTATTGTTGACCTGGAAAAAAAAAAACTGCCATCAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGC
-
SpeciesM. musculus (mouse)
-
Entrez GeneIdua (a.k.a. 6030426D08)
- Promoter Human U6 and mouse U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Circular 200,100 (mIDUA) was a gift from Prashant Mali (Addgene plasmid # 170123 ; http://n2t.net/addgene:170123 ; RRID:Addgene_170123) -
For your References section:
Efficient in vitro and in vivo RNA editing via recruitment of endogenous ADARs using circular guide RNAs. Katrekar D, Yen J, Xiang Y, Saha A, Meluzzi D, Savva Y, Mali P. Nat Biotechnol. 2022 Feb 10. pii: 10.1038/s41587-021-01171-4. doi: 10.1038/s41587-021-01171-4. 10.1038/s41587-021-01171-4 PubMed 35145312