-
PurposeThis Cre-ERT2 expressing construct can be used to inducibly recombine loxp sites. It can be used with poly-loxP containing plasmids to generate timestamp barcodes useful for linage tracing
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170186 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGIR-EF1aFULL-CreERT2-Cterm3xFlag-T2A-eBFP2
-
Backbone manufacturerBernstein Lab
- Backbone size w/o insert (bp) 7314
- Total vector size (bp) 10167
-
Vector typeLentiviral
-
Selectable markerseBFP2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsGrow on LB agar plates at 30 degrees, shaking at 37 in LB broth
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCreERT2-T2A-eBFP2
-
SpeciesSynthetic
-
Insert Size (bp)2853
- Promoter EF1 alpha
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site xbalI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer -
- 3′ sequencing primer agctgacaggtggtggcaat
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p-EF1a-CreERT2-3Xflag-T2A-eBFP2 was a gift from Bradley Bernstein (Addgene plasmid # 170186 ; http://n2t.net/addgene:170186 ; RRID:Addgene_170186) -
For your References section:
Parallel Single-Cell RNA-Seq and Genetic Recording Reveals Lineage Decisions in Developing Embryoid Bodies. Kim IS, Wu J, Rahme GJ, Battaglia S, Dixit A, Gaskell E, Chen H, Pinello L, Bernstein BE. Cell Rep. 2020 Oct 6;33(1):108222. doi: 10.1016/j.celrep.2020.108222. 10.1016/j.celrep.2020.108222 PubMed 33027665