pME-mCD8mCherry
(Plasmid
#170206)
-
PurposeGateway middle entry vector that encodes mCD8mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170206 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepME
- Backbone size w/o insert (bp) 2701
- Total vector size (bp) 4125
-
Vector typeZebrafish
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCD8
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1380
- Promoter none
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTAATACGACTCACTATAGGG
- 3′ sequencing primer CCCTATAGTGAGTCGTATTACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pME-mCD8mCherry was a gift from Kelly Monk (Addgene plasmid # 170206 ; http://n2t.net/addgene:170206 ; RRID:Addgene_170206) -
For your References section:
Live-imaging of astrocyte morphogenesis and function in zebrafish neural circuits. Chen J, Poskanzer KE, Freeman MR, Monk KR. Nat Neurosci. 2020 Oct;23(10):1297-1306. doi: 10.1038/s41593-020-0703-x. Epub 2020 Sep 7. 10.1038/s41593-020-0703-x PubMed 32895565