pLV.CMV.flex.hM3Dq.Cherry
(Plasmid
#170360)
-
PurposeCre-inducible lentiviral vector expressing hM3Dq
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV
- Backbone size w/o insert (bp) 6979
- Total vector size (bp) 9779
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameflex.hM3Dq.Cherry
-
SpeciesSynthetic
-
Insert Size (bp)6979
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cagagctcgtttagtgaacc
- 3′ sequencing primer taccagtcaatctttcacaaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV.CMV.flex.hM3Dq.Cherry was a gift from Johan Jakobsson (Addgene plasmid # 170360 ; http://n2t.net/addgene:170360 ; RRID:Addgene_170360) -
For your References section:
Microglial activation elicits a negative affective state through prostaglandin-mediated modulation of striatal neurons. Klawonn AM, Fritz M, Castany S, Pignatelli M, Canal C, Simila F, Tejeda HA, Levinsson J, Jaarola M, Jakobsson J, Hidalgo J, Heilig M, Bonci A, Engblom D. Immunity. 2021 Feb 9;54(2):225-234.e6. doi: 10.1016/j.immuni.2020.12.016. Epub 2021 Jan 20. 10.1016/j.immuni.2020.12.016 PubMed 33476547